模型:
zhihan1996/DNABERT-2-117M
DNABERT-2 is a transformer-based genome foundation model trained on multi-species genome.
To load the model from huggingface:
import torch
from transformers import AutoTokenizer, AutoModel
tokenizer = AutoTokenizer.from_pretrained("zhihan1996/DNABERT-2-117M", trust_remote_code=True)
model = AutoModel.from_pretrained("zhihan1996/DNABERT-2-117M", trust_remote_code=True)
 To calculate the embedding of a dna sequence
dna = "ACGTAGCATCGGATCTATCTATCGACACTTGGTTATCGATCTACGAGCATCTCGTTAGC" inputs = tokenizer(dna, return_tensors = 'pt')["input_ids"] hidden_states = model(inputs)[0] # [1, sequence_length, 768] # embedding with mean pooling embedding_mean = torch.mean(hidden_states[0], dim=0) print(embedding_mean.shape) # expect to be 768 # embedding with max pooling embedding_max = torch.max(hidden_states[0], dim=0)[0] print(embedding_max.shape) # expect to be 768